Top » Catalog » SNPs » ALK601

$18.00

ALK601
[ALK601]

ALK601
hg38 Position: ChrY:21418385..21418385
Ancestral: G
Derived: C
Reference: Ahmad Al Khuraiji (2018)
ISOGG Haplogroup: J1a
Comments: Below FGC2
Forward Primer: ALK601_F CTTCCTATTGGTTTCAAGGTTCC
Reverse Primer: ALK601_R TCTTTGAAATGTGTGTCTAGCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies