Top » Catalog » SNPs » FT144327

$18.00

FT144327
[FT144327]

FT144327
hg38 Position: ChrY:19907733..19907733
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below ZS1297
Forward Primer: FT144327_F TTTCTGGCTTTTGCTTAGTTCAC
Reverse Primer: FT144327_R CGGAAATTTCAAAACTTGCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies