Top » Catalog » SNPs » FGC30733

$18.00

FGC30733
[FGC30733]

FGC30733
hg38 Position: ChrY:19257380..19257380
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L371
Forward Primer: FGC30733_F ATAGACATCTACAGAGCTCTTCACCTG
Reverse Primer: FGC30733_R ATTGTGATGTTAGGATATCAAGTTTCA
Reviews

Customers who bought this product also purchased
FGC30731
FGC30731
FGC30631
FGC30631
FGC30730
FGC30730
FGC30630
FGC30630
FGC30729
FGC30729
FGC30737
FGC30737
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies