Top » Catalog » SNPs » ZS7725

$18.00

ZS7725
[ZS7725]

ZS7725
hg38 Position: ChrY:16977375..16977375
Ancestral: G
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Below FGC11 > ZS5010
Forward Primer: ZS7725_F GCACTTTCTAATACTCCTCATACAGC
Reverse Primer: ZS7725_R GAGACAAGGTCTCTGTTACCGAC
Reviews

Customers who bought this product also purchased
FGC1707
FGC1707
FGC4474
FGC4474
BY194659
BY194659
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC5427
FGC5427
FGC87741
FGC87741
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies