Top » Catalog » SNPs » ZS7725

$18.00

ZS7725
[ZS7725]

ZS7725
hg38 Position: ChrY:16977375..16977375
Ancestral: G
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Below FGC11 > ZS5010
Forward Primer: ZS7725_F GCACTTTCTAATACTCCTCATACAGC
Reverse Primer: ZS7725_R GAGACAAGGTCTCTGTTACCGAC
Reviews

Customers who bought this product also purchased
FGC5
FGC5
ZS5010
ZS5010
FTB35151
FTB35151
FGC1696
FGC1696
FGC7393
FGC7393
ZS5005
ZS5005
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies