Top » Catalog » SNPs » FT125079

$18.00

FT125079
[FT125079]

FT125079
hg38 Position: ChrY:12606178..12606178
Ancestral: A
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: FT125079_F CTGATATCTGCAACTGATTTGGTAATAC
Reverse Primer: FT125079_R GGGAAGTTTTCAGATGATCCC
Reviews

Customers who bought this product also purchased
FT125162
FT125162
FT125093
FT125093
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies