Top » Catalog » SNPs » FGC19288

$18.00

FGC19288
[FGC19288]

FGC19288
hg38 Position: ChrY:19427715..19427715
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: Below Y33 > YP1448
Forward Primer: FGC19288_F CACAAAAGAAGTGTAAATGGCTAGTG
Reverse Primer: FGC19288_R GAGCTCATGTACCTTCAATCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies