Top » Catalog » SNPs » Y47118

$18.00

Y47118
[Y47118]

Y47118
hg38 Position: ChrY:8471633..8471633
Ancestral: C
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y47118_F GCCCACTAAGAGAATGTGGC
Reverse Primer: Y47118_R CATATCACCTAGAGTTTGGCCTAAAC
Reviews

Customers who bought this product also purchased
Y55108
Y55108
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies