Top » Catalog » SNPs » Y55108

$18.00

Y55108
[Y55108]

Y55108
hg38 Position: ChrY:16835420..16835420
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y55108_F CCGGAACCTAAATCCAGGG
Reverse Primer: Y55108_R GGGGGGCTTTTATATTTAGGTTC
Reviews

Customers who bought this product also purchased
Y47118
Y47118
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies