Top » Catalog » SNPs » YSC0000033

$18.00

YSC0000033
[YSC0000033]

YSC0000033
hg38 Position: ChrY:15241264..15241264
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2b2a1a1b1a1a1a1b
Comments: Below Z725 > L42 > Z30642
Forward Primer: YSC33_F TCCTTAAAATAGCAGAAGAAAGAACTG
Reverse Primer: YSC33_R TTACTCATGGGCAGTGAGACAG
Reviews

Customers who bought this product also purchased
Y128738
Y128738
Z39501
Z39501
L43
L43
M438
M438
M201
M201
Z30642
Z30642
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies