Top » Catalog » SNPs » YSC0000033

$18.00

YSC0000033
[YSC0000033]

YSC0000033
hg38 Position: ChrY:15241264..15241264
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2b2a1a1b1a1a1a1b
Comments: Below Z725 > L42 > Z30642
Forward Primer: YSC33_F TCCTTAAAATAGCAGAAGAAAGAACTG
Reverse Primer: YSC33_R TTACTCATGGGCAGTGAGACAG
Reviews

Customers who bought this product also purchased
DYS617
DYS617
DYS640
DYS640
YSEQ-Gamma
YSEQ-Gamma
DYS626
DYS626
DYS463
DYS463
DYF406S1
DYF406S1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies