Top » Catalog » SNPs » FT187398

$18.00

FT187398
[FT187398]

FT187398
hg38 Position: ChrY:14511293..14511293
Ancestral: C
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT187398_F CAGAGGCAGTAATCCCTTCG
Reverse Primer: FT187398_R CTACCTCTGCCAGCTGCTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies