Top » Catalog » SNPs » Y136207

$18.00

Y136207
[Y136207]

Y136207
hg38 Position: ChrY:21063923..21063923
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y136207_F TGCACCCTTAAAGTGAGATGTAAC
Reverse Primer: Y136207_R CAAAGCTGTCAGACAGCGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies