Top » Catalog » SNPs » A25648

$18.00

A25648
[A25648]

A25648
hg38 Position: ChrY:12589434..12589434
Ancestral: G
Derived: A
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A25648_F TTTTAGCAGGTTGTCAAGTCTCC
Reverse Primer: A25648_R AAAATATGTTTCAAAAACTAGAGTAAACCC
Reviews

Customers who bought this product also purchased
A25650
A25650
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies