Top » Catalog » SNPs » A25774

$18.00

A25774
[A25774]

A25774
hg38 Position: ChrY:10241926..10241926
Ancestral: G
Derived: A
Reference: Darrell Beam (2019)
ISOGG Haplogroup: R1b
Comments: Below DF19 > L644 > BY207485 > BY79552
Forward Primer: A25774_F TGTTGGCCTGCCTTGTTG
Reverse Primer: A25774_R CGGTTCATGAATATCCACTATTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies