Top » Catalog » SNPs » FT34352

$18.00

FT34352
[FT34352]

FT34352
hg38 Position: ChrY:12160359..12160359
Ancestral: G
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below DF19 > L644 > BY207485 > BY79552
Forward Primer: FT34352_F ACCCCAAAGCCCAGAGTTC
Reverse Primer: FT34352_R GCAGTATTACTGAGAATTAAGTCCTAACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies