Top » Catalog » SNPs » F1771

$18.00

F1771
[F1771]

F1771
hg38 Position: ChrY:12216488..12216488
Ancestral: T
Derived: C
Reference: Yan Shi (2011)
ISOGG Haplogroup: D
Comments: Found in a hg D person.
Forward Primer: F1771_F TGTGCAGGACACATGTCCAG
Reverse Primer: F1771_R CAGGAGAGTAACAAGAAGTGCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies