Top » Catalog » SNPs » Y14741

$18.00

Y14741
[Y14741]

Y14741
hg38 Position: ChrY:7326335..7326335
Ancestral: A
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: D
Comments: .
Forward Primer: Y14741_F GGGGCCCTGAGCGTATG
Reverse Primer: Y14741_R ACACAGATACAATTGCCTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies