Top » Catalog » SNPs » Y14813

$18.00

Y14813
[Y14813]

Y14813
hg38 Position: ChrY:14653240..14653240
Ancestral: A
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: D
Comments: .
Forward Primer: Y14813_F GTGACATTTGAATGATCCTTGG
Reverse Primer: Y14813_R AAAAATAATAATAAAAAAAGTTTAGCCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies