Top » Catalog » SNPs » BY82357

$18.00

BY82357
[BY82357]

BY82357
hg38 Position: ChrY:10141970..10141970
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: Below M458 > L1029 > BY32105
Forward Primer: BY82357_F GCACACCCCAGTAAACCAGG
Reverse Primer: BY82357_R GGCATCATAAGTATGTCTGTATGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies