Top » Catalog » SNPs » BY82357

$18.00

BY82357
[BY82357]

BY82357
hg38 Position: ChrY:10141970..10141970
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: Below M458 > L1029 > BY32105
Forward Primer: BY82357_F GCACACCCCAGTAAACCAGG
Reverse Primer: BY82357_R GGCATCATAAGTATGTCTGTATGGC
Reviews

Customers who bought this product also purchased
BY30715
BY30715
YP263
YP263
FGC66342
FGC66342
BY164730
BY164730
YP417
YP417
YP4648
YP4648
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies