Top » Catalog » SNPs » BY218801

$18.00

BY218801
[BY218801]

BY218801
hg38 Position: ChrY:20278470..20278470
Ancestral: A
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below Z2106 > CTS9219 > Y33200
Forward Primer: BY218801_F GCAGACCTTAGTGGTGAGTGTTG
Reverse Primer: BY218801_R CGTAAAGGTCTGCAGCTTCTTC
Reviews

Customers who bought this product also purchased
FT63546
FT63546
Y32147
Y32147
Y33200
Y33200
A1777
A1777
R1b-Z2103 Panel
R1b-Z2103 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies