Top » Catalog » SNPs » FT122534

$18.00

FT122534
[FT122534]

FT122534
hg38 Position: ChrY:18886612..18886612
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT122534_F TTTCCTGAACATTACTAATATATCCTTTTAGC
Reverse Primer: FT122534_R GAGCTTTTTTTCATATGCTTGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies