Top » Catalog » SNPs » Y32988

$18.00

Y32988
[Y32988]

Y32988
hg38 Position: ChrY:16825499..16825499
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y32988_F CGGACGCAGTTGCTCAAG
Reverse Primer: Y32988_R TGAATTGTATTTTAGACAGATACTTGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies