Top » Catalog » SNPs » Y16646

$18.00

Y16646
[Y16646]

Y16646
hg38 Position: ChrY:12401560..12401560
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y16646_F GAGGTATGGGGTATGCATGAAC
Reverse Primer: Y16646_R TTTGTCCTGCCTTTCCAGAC
Reviews

Customers who bought this product also purchased
FGC5
FGC5
Z18297
Z18297
Y138150
Y138150
M96
M96
ZS4313
ZS4313
Y136125
Y136125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies