Top » Catalog » SNPs » Y54081

$18.00

Y54081
[Y54081]

Y54081
hg38 Position: ChrY:15918493..15918493
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below CTS595 > L233 > A7111
Forward Primer: Y54081_F TGATAGCTTTGAGAAAACATACAAATG
Reverse Primer: Y54081_R TCTCTGAAAGAAAATTATGGCTCTG
Reviews

Customers who bought this product also purchased
A10033
A10033
A7111
A7111
L233
L233
Y33761
Y33761
A15076
A15076
Y4252
Y4252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies