Top » Catalog » SNPs » Y54081

$18.00

Y54081
[Y54081]

Y54081
hg38 Position: ChrY:15918493..15918493
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below CTS595 > L233 > A7111
Forward Primer: Y54081_F TGATAGCTTTGAGAAAACATACAAATG
Reverse Primer: Y54081_R TCTCTGAAAGAAAATTATGGCTCTG
Reviews

Customers who bought this product also purchased
Y33761
Y33761
A15076
A15076
Y4252
Y4252
A15050
A15050
A19485
A19485
Y4200
Y4200
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies