Top » Catalog » SNPs » Y54081

$18.00

Y54081
[Y54081]

Y54081
hg38 Position: ChrY:15918493..15918493
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below CTS595 > L233 > A7111
Forward Primer: Y54081_F TGATAGCTTTGAGAAAACATACAAATG
Reverse Primer: Y54081_R TCTCTGAAAGAAAATTATGGCTCTG
Reviews

Customers who bought this product also purchased
Y4200
Y4200
FGC56815
FGC56815
Y138217
Y138217
M26
M26
A19385
A19385
A417
A417
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies