Top » Catalog » SNPs » Y54081

$18.00

Y54081
[Y54081]

Y54081
hg38 Position: ChrY:15918493..15918493
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below CTS595 > L233 > A7111
Forward Primer: Y54081_F TGATAGCTTTGAGAAAACATACAAATG
Reverse Primer: Y54081_R TCTCTGAAAGAAAATTATGGCTCTG
Reviews

Customers who bought this product also purchased
Y138217
Y138217
M26
M26
A19385
A19385
A417
A417
I2a-CTS595 Panel
I2a-CTS595 Panel
A10033
A10033
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies