Top » Catalog » SNPs » A26025

$18.00

A26025
[A26025]

A26025
hg38 Position: ChrY:16665262..16665262
Ancestral: C
Derived: A
Reference: YSEQ (2019)
ISOGG Haplogroup: N
Comments:
Forward Primer: A26025_F AATAGAACACATCCTTCTCTTCATATCC
Reverse Primer: A26025_R CATGCCTGTCCTGCGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies