Top » Catalog » SNPs » F9789

$18.00

F9789
[F9789]

F9789
hg38 Position: ChrY:7260297..7260297
Ancestral: G
Derived: C
Reference: Fudan University (2016)
ISOGG Haplogroup: C2b
Comments: .
Forward Primer: F9789_F GTGGTGCAATGAGCTAAGATCC
Reverse Primer: F9789_R ATACATTCTGTCCTGGAGCCTG
Reviews

Customers who bought this product also purchased
F5485
F5485
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies