Top » Catalog » SNPs » A26253

$18.00

A26253
[A26253]

A26253
hg38 Position: ChrY:7088867..7088867
Ancestral: A
Derived: G
Reference: YSEQ (2020)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A26253_F CAATCAGTTAGGAGGAGCTTATCATC
Reverse Primer: A26253_R TGTCTGAATGAATACAATTGACCTG
Reviews

Customers who bought this product also purchased
A26251
A26251
A26257
A26257
A26262
A26262
R1a-YP4517 Kianicka Panel
R1a-YP4517 Kianicka Panel
FT87057
FT87057
A26256
A26256
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies