Top » Catalog » SNPs » A26256

$18.00

A26256
[A26256]

A26256
hg38 Position: ChrY:12614671..12614671
Ancestral: A
Derived: T
Reference: YSEQ (2020)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A26256_F GGTGTGCTGTATTCAGGAGACTG
Reverse Primer: A26256_R TCCCTTAATTTCATTGTTTGCCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies