Top » Catalog » SNPs » A26256

$18.00

A26256
[A26256]

A26256
hg38 Position: ChrY:12614671..12614671
Ancestral: A
Derived: T
Reference: YSEQ (2020)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A26256_F GGTGTGCTGTATTCAGGAGACTG
Reverse Primer: A26256_R TCCCTTAATTTCATTGTTTGCCT
Reviews

Customers who bought this product also purchased
A26252
A26252
A26258
A26258
A26263
A26263
A26251
A26251
A26257
A26257
A26262
A26262
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies