Top » Catalog » SNPs » A26258

$18.00

A26258
[A26258]

A26258
hg38 Position: ChrY:13164675..13164675
Ancestral: T
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A26258_F CCACGTGCTGATGCATG
Reverse Primer: A26258_R GCAGAATCTCACTCTATTGCCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies