Top » Catalog » SNPs » A26258

$18.00

A26258
[A26258]

A26258
hg38 Position: ChrY:13164675..13164675
Ancestral: T
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A26258_F CCACGTGCTGATGCATG
Reverse Primer: A26258_R GCAGAATCTCACTCTATTGCCG
Reviews

Customers who bought this product also purchased
A26254
A26254
A26260
A26260
A26610
A26610
A26253
A26253
A26259
A26259
A26264
A26264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies