Top » Catalog » SNPs » A26261

$18.00

A26261
[A26261]

A26261
hg38 Position: ChrY:14808310..14808310
Ancestral: A
Derived: C
Reference: YSEQ (2020)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A26261_F GGCATGATCTCCGCACAC
Reverse Primer: A26261_R CATGTTACACAAAGGTCATTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies