Top » Catalog » SNPs » A26261

$18.00

A26261
[A26261]

A26261
hg38 Position: ChrY:14808310..14808310
Ancestral: A
Derived: C
Reference: YSEQ (2020)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A26261_F GGCATGATCTCCGCACAC
Reverse Primer: A26261_R CATGTTACACAAAGGTCATTTGC
Reviews

Customers who bought this product also purchased
BY25697
BY25697
A26254
A26254
A26259
A26259
A26610
A26610
A26253
A26253
A26258
A26258
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies