Top » Catalog » SNPs » Y65994

$18.00

Y65994
[Y65994]

Y65994
hg38 Position: ChrY:12006831..12006831
Ancestral: A
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: I1
Comments: Below L22 > L813 > Y5483
Forward Primer: Y65994_F GAGCTTTGGGAAAACATATTCC
Reverse Primer: Y65994_R GCTTTTATACTAGATTTCCTGGCACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies