Top » Catalog » SNPs » FT201107

$18.00

FT201107
[FT201107]

FT201107
hg38 Position: ChrY:8141565..8141565
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT201107_F GAATAGAAGTAATGTTTTTGAGAAGGGT
Reverse Primer: FT201107_R CCTTTATCTCTAAGTAATTGGCTCTATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies