Top » Catalog » SNPs » Y110952

$18.00

Y110952
[Y110952]

Y110952
hg38 Position: ChrY:21032486..21032486
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y110952_F AATAAAAACAATTATCCAACGCTAAAG
Reverse Primer: Y110952_R GGCACAAAGCCTGTCATCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies