Top » Catalog » SNPs » A5023

$17.50

A5023
[A5023]

A5023
HG19 Position: ChrY:14735765..14735765
Ancestral: T
Derived: C
Reference: Desideriu Ramelet-Stuart (2015)
ISOGG Haplogroup: R1b1a2a1a2c1i1a (not listed)
Comments: Downstream S781
Forward Primer: A5023_F TGCTAAACATCCAGCCAAAAC
Reverse Primer: A5023_R GCATAGAATTTGTATATTGCTTGCAG
Reviews

Customers who bought this product also purchased
A5028
A5028
A889
A889
S768
S768
R1b-DF41 Panel (including Royal Stewart clades)
R1b-DF41 Panel (including Royal Stewart clades)
A919
A919
S781
S781
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies