Top » Catalog » SNPs » A5023

$18.00

A5023
[A5023]

A5023
HG19 Position: ChrY:14735765..14735765
Ancestral: T
Derived: C
Reference: Desideriu Ramelet-Stuart (2015)
ISOGG Haplogroup: R1b1a2a1a2c1i1a (not listed)
Comments: Downstream S781
Forward Primer: A5023_F TGCTAAACATCCAGCCAAAAC
Reverse Primer: A5023_R GCATAGAATTTGTATATTGCTTGCAG
Reviews

Customers who bought this product also purchased
A5028
A5028
A306
A306
S310
S310
A922
A922
A889
A889
S768
S768
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies