Top » Catalog » SNPs » FGC77583

$18.00

FGC77583
[FGC77583]

FGC77583
hg38 Position: ChrY:11277462..11277462
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC77583_F ATCTGGGGCTGAATAGCTTAAC
Reverse Primer: FGC77583_R AGGTGGGGTTTTGCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies