Top » Catalog » SNPs » A5024

$19.00

A5024
[A5024]

A5024
hg38 Position: ChrY:12652016..12652016
Ancestral: A
Derived: C
Reference: Desideriu Ramelet-Stuart (2015)
ISOGG Haplogroup: R1b1a2a1a2c1i1a (not listed)
Comments: Downstream S781
Forward Primer: A5024_F GAAACAACATATTTTATCCATTTATCAGTTG
Reverse Primer: A5024_R AAAGTCTCAACGCCATCAGC
Reviews

Customers who bought this product also purchased
A5025
A5025
A2509
A2509
A5027
A5027
A5026
A5026
A5023
A5023
A5020
A5020
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies