Top » Catalog » SNPs » Z38299

$18.00

Z38299
[Z38299]

Z38299
hg38 Position: ChrY:14227327..14227327
Ancestral: T
Derived: A
Reference: Chris Rottensteiner (2015)
ISOGG Haplogroup: J2b1
Comments: Below L283 > Z638 > Y20899
Forward Primer: Z38299_F TTCTCCACATAAAATGTCGTGTTAC
Reverse Primer: Z38299_R CTTAATAGGGCTTATCTGGGTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies