Top » Catalog » SNPs » CTS6190

$18.00

CTS6190
[CTS6190]

CTS6190
hg38 Position: ChrY:14607038..14607038
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2b2 (not listed)
Comments: Below M12 > CTS3617
Forward Primer: CTS6190_F AATAACTTCCCTGCAGAGGATG
Reverse Primer: CTS6190_R GTTGAAAGGTGCAGTAAACTACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies