Top » Catalog » SNPs » FT170344

$18.00

FT170344
[FT170344]

FT170344
hg38 Position: ChrY:17127944..17127944
Ancestral: C
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT170344_F CACAATATAATGAAACATTCTTTTTCG
Reverse Primer: FT170344_R CAATGTTTATTTGAAAAGCTCAATAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies