Top » Catalog » SNPs » Y109329

$18.00

Y109329
[Y109329]

Y109329
hg38 Position: ChrY:20469990..20469990
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: S
Comments: .
Forward Primer: Y109329_F CAGGAGGCAGAGGTTGTTG
Reverse Primer: Y109329_R TCCCTTTAGGCACACTACAATGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies