Top » Catalog » SNPs » A26361

$18.00

A26361
[A26361]

A26361
hg38 Position: ChrY:12132575..12132575
Ancestral: C
Derived: A
Reference: Svatoslav Brtnik (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A26361_F GGAAGGGTTGATTTTGCTGTG
Reverse Primer: A26361_R CAATGATTAGAAGAATATAATCCATGAAAG
Reviews

Customers who bought this product also purchased
A26363
A26363
A26362
A26362
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies