Top » Catalog » SNPs » A26363

$18.00

A26363
[A26363]

A26363
hg38 Position: ChrY:19105910..19105910
Ancestral: C
Derived: A
Reference: Svatoslav Brtnik (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A26363_F CTTTTGATTAGGAAAAGTGGCAC
Reverse Primer: A26363_R GGGGTGAATGCCATCTCC
Reviews

Customers who bought this product also purchased
A26362
A26362
A26361
A26361
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies