Top » Catalog » SNPs » S2788

$18.00

S2788
[S2788]

S2788
HG19 Position: ChrY:7348775..7348775
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: G2a2b2a1a1b1a2a1d2~
Comments: Below Z726 > S2808 > S2784
Forward Primer: S2788_F GGTAGGATTACTGGCATATGTCAG
Reverse Primer: S2788_R TTTTAATGCAATCATCCACCTATC
Reviews

Customers who bought this product also purchased
S23438
S23438
S2808
S2808
Z726
Z726
PH239
PH239
Z725
Z725
S2784
S2784
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies