Top » Catalog » SNPs » S2788

$18.00

S2788
[S2788]

S2788
hg38 Position: ChrY:7348775..7348775
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: G2a2b2a1a1b1a2a1d2~
Comments: Below Z726 > S2808 > S2784
Forward Primer: S2788_F GGTAGGATTACTGGCATATGTCAG
Reverse Primer: S2788_R TTTTAATGCAATCATCCACCTATC
Reviews

Customers who bought this product also purchased
Z725
Z725
S2784
S2784
G2a-L497 Panel
G2a-L497 Panel
Z30739
Z30739
S23438
S23438
S2808
S2808
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies